Can a "nonsense" strand of DNA produce proteins?

Question

I have this Biology question and I thought that only the "sense" strand is used for the production of proteins. Is it a trick question?

Here is the question in its original context:
"4. Use the following "nonsense" strand of DNA and determine the proteins that would be produced by this "gene"."

Answer 1

What a terrific question. This has always caused confusion for me too.



Here is how I understand it....and maybe I've been wrong all these years.



Other responders will correct me if so.



Each strand of a DNA molecule can code for something. But we talk about it in a 5' to 3' orientation. That is the way polymerases read DNA. And this is the way scientist know which strand is being discussed.



But the opposite strand (3' to 5') can also be read in a 5' to 3' direction (and I think this might depend on the polymerase).



Here is an example using a words:



5'dog3'

3'god5'



In this case each strand can code for something, either god or dog.



I'm sure that there are cases where the opposite sequence codes for nothing.



Just keep in mind, you get one strand from mom and one strand from dad.



You don't inherit one strand that is "non-sense" and therefor non-functional.



You inherit two functional strands (in general).



You inherit two copies of each gene, one from each parent.



One gene is present on each strand.



So this was a trick question, in this "sense": the non-sense strand would not code for the same protein at that exact sequence location. However, the non-sense strand may code for another protein at that exact sequence location.



But somewhere on the non-sense strand is the sequence for the same protein on the sense strand.



I can say the same thing with different words.



The DNA sequence for a protein on one strand will not be found directly opposite its sequence.



Here is a visual:



5'sequence sequence dog sequence 3'

3'sequence god sequence sequence 5'



In this case, dog and god code for the same protein but what it is based paired with is quite different.



Hope my complex example helps to simplify the concept.



Spread the Good Karma around!



dumbdumb

Answer 2

Your question mentions "strand", not a fragment or a chromosome. Therefore, we are not talking about introns/junk DNA or maternal/paternal inheritance. Some people might call "non-coding" strand "nonsense". In a double-stranded DNA molecule, this is a strand complementary to the coding strand. If the coding strand is 5-ATTCCGG-3, the non-coding will go 5-CCGGAAT-3 (mind the polarity). In real genomes it is not uncommon for protein-coding genes to be transcribed in opposite directions. In this case, what is a coding strand for one gene, is a non-coding strand for the other. In fact, the genes may even overlap on opposite strands.I have seen some gene pairs for which exons of the one are encoded opposite to the introns of the other. I suppose, they are not transcribed simultaneously, but rather in turns or in different cells altogether.

It is quite likely that whoever composed the original question #4 is not well versed in genetic terminology. I can imagine that they gave you a sequence and simply wanted you to produce and translate (substituting Ts for Us, as if it were an RNA) the anti-sense version of it. You can easily do it by remembering the complementarity rules and genetic code, while minding polarity and special codons (start and stop).

Answer 3

It's true that the nonsense strand is not used for the production of proteins, and it's called like that because of it; scientifically, this sequences are called introns. I think your teacher made a real trick question, or a hypothetical question, or maybe he is only trying to make you realize that these strands shouldn't be called nonsense strands, some teachers are just weird. :) Anyway, check the strand your teacher gave you, you can just determine the proteins (every 3 nucleotids is a codon, and every codon a protein, as you know) and then add that if the strand is made of introns, the proteins would not be synthesised, but probably were, sometime in evolution, but now only remain as not codifying nucleotids.

Answer 4

The strand can be translated by codon triplets. Any given segment could be translated until a stop codon is encountered starting from any of the first three positions.

Therefore three possible reading frames exist for each strand.



Does the sequence include a start site? There is usually a consensus sequence to initiate transcription within 20 bp of the ATG start codon. Does the Kozac eukaryote sequence ring a bell? In Prokaryotes it is more complicated but there are initiation factors near by the ATG still.



If start sites aren't expected then translations start ATG. Scan through by even units of three to read til a stop codon is met.

The ATG to stop is your open reading frame.

If you have an ATG in all three frames then go with the longest to shortest as 'best' to 'worst' translation possible.



If this were real the the different transcripts may encode different proteins (isoforms) with, when different promoters are used, different N-terminal sequences - a first amino acid, a unique +1 Met can thus not be assigned.

Remember ATG -> Met

Stop codons are TAG, TAA, TGA

Answer 5

first - you are missing the notation for 3' and 5' ends once you determine that you find your start codon and and read the frame in the correct direction. This question is designed to test your knowledge of the correct reading frame direction and typically they will display the DNA strand in the opposite direction to see if you notice which end is which.

Answer 6

The only thing that is nonsense about DNA is someone's understanding of it. That part of the DNA may not be used for protein production, but does not mean it does not have a purpose.

Answer 7

I have this exact question (number and all) but the letters are:

AAATGCTACGATGCTACAGTGACATGCCGA



I was wondering about his one too and i think that you still use the same codon as would be produced... but I'm not all THAT sure.......