Why do the Darwinists assert that gene duplication leads to new biological information?

Question

All of the available evidence is that gene duplication is not a force for innovation in biology. Gene duplicates either degenerate ,because of a relaxed regime of purifying selection, or serve as back ups that compensate for loss of function mutations at paralogous sites: Sometimes, gene duplicates can divide functions amongst each other.

http://gbe.oxfordjournals.org/cgi/content/full/1/0/409

http://www.nature.com/nature/journal/v421/n6918/full/nature01198.html

So why do the Darwinists claim, or rather lie, that gene duplication leads to new information and functionality when this is so manifestly false?

Is there anything about the T of E that is falsifiable?

Answer 1

Why ask a question about gene duplication saying on beforehand that darwinists are lying on this matter?



Anyway, gene duplication can indeed degenerate, compensate, just like you say. But they do not arise as with an intention to be a functional back-up for a certain gene; it is actually the other way round. Gene duplication might arise due to faults in mitosis, unequal crossing over during meiosis, transposons, etc. A duplicated gene, or a paralog, is a site were mutations can happen without being directly harmful. This way, the duplicated gene is able to change over time (over generations). Eventually a 'new' gene may arise with a beneficial function. There's a lot of evidence that this has led to big bursts of change, major events in evolution are driven by this.



A lot of plant species duplicate entire genomes, without a problem. Think about triploids (3n) or tetraploids (4n), polyploids... These are all perfectly functioning plants, that often gained advantages over their predecessors.



Gene duplication can also lead to over expression of the gene. This is likely to be harmful to the organism, but it might also be an advantage. For example; flowers generate pigment to color their petals. This attracts insects needed for pollination. Flowers with brighter colors (due to over expression of a gene) attract more insects than 'normal' flowers.. see the picture?

Answer 2

As I understand it, "new information" and "new functionality" are separate, albeit slightly related, areas of concern within the theory of evolution (and more generally, within information theory). "Information" usually has a very specific definition, closely related to the concept of entropy. I'll speak in terms of entropy, since the technical meaning of "information" is semantically confusing and frankly less useful.



For reference, a sequence with high entropy is very disordered and random compared to a sequence with low entropy. So "AGCATGTATCAATGTTATGAATCTG" is high entropy, while "AAAAAAAAAAAAAAAAAAAAA" is low entropy, and so forth.



Comparing the average entropy of a genome with and without a gene duplication, you will almost always find that the genome with the duplication has the lower entropy. Why? Because genes are very ordered, and therefore have fairly low entropy. Duplicating a gene increases the amount of average amount of order in the genome, period.



As for new functionality, I believe that you're misunderstanding the dialog surrounding gene duplications. Duplications are not seen as the direct cause of new functionality. That task falls to the other types of mutation, which can more precisely modify the regulation and phisiochemical properties of a protein. Instead, gene duplications provide the refined material that the other mutations can work on. To make a (bad) analogy, a gene duplication is like a copy of a drawing. Other mutations are like an artist's tools; they remove, change, and add to the new drawing. The new drawing has no intrinsic functionality vs the old drawing, but the new copy can be modified without messing up the original.



Just as a parting shot, I'd like to point out that crying "liar" makes you look like a complete scumbag. Ascribing malice where human error would be a simpler explanation is a sure sign of a lousy person.

Answer 3

Biological information is a creationist construct and has little to do the way the theory of evolution is discussed by actual scientists.



If all evidence points to gene duplication not being a force in innovation why on earth would present two papers that show that duplicate genes are ofter superfluous, the whole point is that superfluous are prime targets to become changed without negatively affecting the fitness of the organism.



If, as you say "Sometimes, gene duplicates can divide functions amongst each other" is the exception why are you saying it is the rule.



Ignorance and incredulity on your part do not constitute a lie on their part.



>>>>Is there anything about the T of E that is falsifiable?



Absolutely, the problem you are having is that you aren't looking for it. Though, asking in the science section shows that you might be somewhat open to new info, your question, however, comes across as a bit narrow minded.

Answer 4

Transition from quantity to quality:

"In his book Science of Logic, Georg Friedrich Hegel remarked: “It is said that there are no sudden changes in nature, and the common view has it that when we speak of a growth or a destruction, we always imagine a gradual growth or disappearance. Yet we have seen cases in which the alteration of existence involves not only a transition from one proportion to another, but also a transition, by a sudden leap, into a…qualitatively different thing; an interruption of a gradual process, differing qualitatively from the preceding, the former state”

Gene duplication can lead to remarkable qualitative changes by itself and also result in the possibility of safe and gradual divergence of duplicated genes for further fine-tuning and changes.



For example, many genes expressed in brain were duplicated some million++ years ago.



You are also forgetting interactions between genotype and phenotype and interactions of the two with environment.

Anyway, I think "lie" and "all Darwinists" words are kind of strong.

Answer 5

Duplication is but one form of mutation.



That said, let's say organism A ends up with a duplicate gene and now produces double the amount of Protein B. Protein B digests substance C. This mutated form of organism A can now extract nutrition from substance C more efficiently. This allows it to mature faster/live longer/produce more sperm/whatever. These things all can be advantages that would lead to greater amounts of offspring that could/would have the mutation. Selective advantage.



That's a made up example I came up with in 2 minutes off the top of my head. Use your eyes and read books.

Answer 6

I think you must be getting your information from creationists. There are two types of creationists: (1) professional liars who deceive innocent people, and (2) innocent people who are deceived by professional liars.



The following publications totally refute your claims:



Lenski, R. E., 1995. Evolution in experimental populations of bacteria. In: Population Genetics of Bacteria, Society for General Microbiology, Symposium 52, S. Baumberg et al., eds., Cambridge, UK: Cambridge University Press, pp. 193-215.



Lenski, R. E., M. R. Rose, S. C. Simpson and S. C. Tadler, 1991. Long-term experimental evolution in Escherichia coli. I. Adaptation and divergence during 2,000 generations. American Naturalist 138: 1315-1341.



Alves, M. J., M. M. Coelho and M. J. Collares-Pereira, 2001. Evolution in action through hybridisation and polyploidy in an Iberian freshwater fish: a genetic review. Genetica 111(1-3): 375-385.



Brown, C. J., K. M. Todd and R. F. Rosenzweig, 1998. Multiple duplications of yeast hexose transport genes in response to selection in a glucose-limited environment. Molecular Biology and Evolution 15(8): 931-942.



Hughes, A. L. and R. Friedman, 2003. Parallel evolution by gene duplication in the genomes of two unicellular fungi. Genome Research 13(5): 794-799.



Lynch, M. and J. S. Conery, 2000. The evolutionary fate and consequences of duplicate genes. Science 290: 1151-1155. See also Pennisi, E., 2000. Twinned genes live life in the fast lane. Science 290: 1065-1066.



Ohta, T., 2003. Evolution by gene duplication revisited: differentiation of regulatory elements versus proteins. Genetica 118(2-3): 209-216.



Knox, J. R., P. C. Moews and J.-M. Frere, 1996. Molecular evolution of bacterial beta-lactam resistance. Chemistry and Biology 3: 937-947.



Park, I.-S., C.-H. Lin and C. T. Walsh, 1996. Gain of D-alanyl-D-lactate or D-lactyl-D-alanine synthetase activities in three active-site mutants of the Escherichia coli D-alanyl-D-alanine ligase B. Biochemistry 35: 10464-10471.



Prijambada, I. D., S. Negoro, T. Yomo and I. Urabe, 1995. Emergence of nylon oligomer degradation enzymes in Pseudomonas aeruginosa PAO through experimental evolution. Applied and Environmental Microbiology 61(5): 2020-2022.

Answer 7

When I first read your question, I was intending to provide a very sarcastic answer.



Unfortunately, I don't know if your ignorance of Biology is willing or unwilling. Coming from a religious family, I was taught to always see the best in people. With this in mind, I will assume you are unwillingly ignorant.



To rectify your ignorance, I would point out a few things.



1. There is no such thing as a "Darwinist" unless you are referring to people who believe in Darwin. He wrote a few books, and you can actually read them.



2. You haven't reviewed all of the available evidence. Don't lie.



3. As to your question, let's do a thought experiment shall we? I have one sentence.

"People who lie need forgiveness."

Now, I am going to duplicate this sentence.

"People who lie need forgiveness. People who lie need forgiveness."

Alright, now I am going to change some words around randomly. I could eventually get this:

"People who lie need forgiveness. People who lie need knowledge."

Do you see how, through my duplication, I in fact increased information?



Now, biologically relevant examples?



Look up the proteins MBD2 and MBD3. They are both intimately involved in different aspects of mouse development.



There is an example for you.



I hope this helps!

Answer 8

There are distinctive varieties of mutation. Insertion, inversion, deletion, duplication, transposition, and ultimately factor. All of those remove or transfer genetic knowledge, however best you can still "upload" that is factor mutation. What the creationist says is right, for factor mutation to "upload" whatever well is not possible to the mathematician. You have genes that may best be taken away, for instance being in a cave for see you later, you can still lose his capacity to peer. And there may be experiment on apartment flies that may "upload" and open unique genes that deliver them extra eyes, wings, legs, ect. But on no account whatever new. Hope this solutions your query.

Answer 9

"Genome duplication in the teleost fish Tetraodon nigroviridis reveals the early vertebrate proto-karyotype"

http://docs.google.com/viewer?a=v&q=cache:py_VrGKrL_IJ:mit.edu/manoli/www/publications/Jaillon_Nature_04.pdf+teleost+fish+timeline&hl=en&gl=us&pid=bl&srcid=ADGEESjChO34q_vKfNgWTEOKaX2YFpKFgujb2vJt1bF5t0kxyBVBbKhveNUUiA_qrxqRvAmPWds_3mzBpgl_noO8SVQ7BKCLzzOGrWP-obnKE1uoHa7vXTSvtz1-vlhNSp05wOKz-y17&sig=AHIEtbRw0hiqITCNaP6QS67HmjiFNnTOgw

This paper begins "Access to entire genome sequences is revolutionizing our understanding of how genetic information is stored and organized in DNA, and how it has evolved over time."

The results show that this teleost lineage experienced a whole genome duplication and massive partial gene loss after it diverged from our tetrapod ancestors. This explains why the ray finned fish today have 7- 8 hox clusters (they experienced one more whole genome duplication than our lineage) while the lobe finned tetrapod lineage has 4 hox clusters.

Hox clusters are the master regulatory proteins that control initial genetic expression in embryogenesis. Changes in these change cell fates.



Another of the changes resulted in an adaptive radiation.

Teleost fish are hypo-osmotic (lose water) to seawater without protection. Skin & kidney functions protect the fish but its eggs were once vulnerable to osmotic imbalances if laid in saline water. Yet some species of these fish adapted to the ocean from fresh water. They transitioned to marine waters by duplicating a gene for egg yolk protein.

The barrier to survival in a marine niche was that the eggs died when they lost water to the environment. Duplicate yolk genes produced twice the volume of protein. This extra protein allowed the excess to degrade to free amino acids and pull water into the egg to keep it hydrated when laid in salt water.

Extra yolk from the duplicate gene altered the osmotic balance in fish eggs allowing fish to lay eggs in the osmotic conditions and have surviving offspring. This chance duplication opened up the ability to survive in a marine habitat.

http://web.mac.com/nigel.finn/Site/Welcome.html

http://www.plosone.org/article/info:doi%2F10.1371%2Fjournal.pone.0000169



Gene duplication and tandem repeats are major mechanisms of enlarging a genome and changing regulation. Variable length tandem repeats can alter the expression of a gene & they can generate alternative splicing patterns by adding new introns.

"Tandem repeats modify the structure of human genes hosted in segmental duplications'

"variation in the number of ITRs impacts on recently duplicated genes by modifying their coding sequence, splicing pattern, and tissue expression."

http://genomebiology.com/2009/10/12/R137

All of this adds to the genetic information.

Answer 10

http://en.wikipedia.org/wiki/Homology_(biology)#Paralogy

Myoglobin and several different hemoglobin subunits